Using Ensembl SNP Data to Generate KASP Markers with PolyMarker
Welcome to PolyMarker! This tool allows you to design your own primers or download pre-designed primers for SNP data from Ensembl. You can create KASP markers by uploading your .csv file containing SNP information, aligning parental sequences, and analyzing SNP markers found using Biomart. Understand the different symbols indicating varietal, homoeologous, genome-specific, and shared SNPs between parentals for effective marker design.
Download Presentation

Please find below an Image/Link to download the presentation.
The content on the website is provided AS IS for your information and personal use only. It may not be sold, licensed, or shared on other websites without obtaining consent from the author. Download presentation by click this link. If you encounter any issues during the download, it is possible that the publisher has removed the file from their server.
E N D
Presentation Transcript
How to go from SNP data in Ensembl to getting KASP markers? Welcome to PolyMarker! http://polymarker.tgac.ac.uk/ Options: 1) Design your own primers 2) Download pre-designed primers for SNP data How to use Biomart to find SNP markers www.wheat-training.com
Option 1: Design primers Upload your .csv file Enter your email address Name/ID , Chromosome , Sequence [SNP/SNP] Sequence Gene_1, 6B, ATGACGATACGGACGACA[A/T]ACGGGGGACGAGGG Gene_1,6B,GATAAGCGATGACGATACGGACGACA[A/T]ACGGGGGACGAGGGATACGAT How to use Biomart to find SNP markers www.wheat-training.com
Create two separate input/parental sequences Align to Chinese spring survey sequence (CSS) How to use Biomart to find SNP markers www.wheat-training.com
Create a mask that summarizes the assembly How to use Biomart to find SNP markers www.wheat-training.com
& means a SNP between the two parentals is varietal, i.e. non-homoeologous; the SNP can be used for a KASP marker How to use Biomart to find SNP markers www.wheat-training.com
A colon means a SNP between the two parentals is homoeologous, i.e. not useful to distinguish genomes SNP cannot be used for a KASP marker How to use Biomart to find SNP markers www.wheat-training.com
A capital letter means a SNP between the two parentals is specific to one genome; Here specific to 1AS How to use Biomart to find SNP markers www.wheat-training.com
A lowercase letter means a SNP between the two parentals is semi-specific, i.e. shared by two genomes; here 1AS and 1DSHow to use Biomart to find SNP markers www.wheat-training.com
How to use Biomart to find SNP markers www.wheat-training.com
Non-homoeologous Chromosome semi-specific SNP is varietal Genome specific SNP Red Boxes around sequence denotes the boundaries of the designed primers How to use Biomart to find SNP markers www.wheat-training.com
Homoeologous Chromosome non-specific SNP is homoeologous No specificity How to use Biomart to find SNP markers www.wheat-training.com
http://polymarker.tgac.ac.uk/Markdown?md=DesignedPrimers Option 2: Use previously designed markers How to use Biomart to find SNP markers www.wheat-training.com
Or get them from CerealsDB http://www.cerealsdb.uk.net/cerealgenomics/CerealsDB/KASP_primers_for_iSelect.php How to use Biomart to find SNP markers www.wheat-training.com